| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.044908 |
| Chromosome: | chromosome 14 |
| Location: | 1222626 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g615850 | EFH8 | EF-hand Calcium binding protein; (1 of 38) IPR002048//IPR011992 - EF-hand domain // EF-hand domain pair | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCGCACGTCACTGACACGGACGTGGTTCGTGGTTGTCGATGGCCAGGG |
| Internal bar code: | TATAAGGAGGTCCGTTGCTCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1485 |
| LEAP-Seq percent confirming: | 76.4706 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCGCGGCCTAAATGTTGTG |
| Suggested primer 2: | TAACCGTTGACGTCATGGCA |