| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.044955 |
| Chromosome: | chromosome 10 |
| Location: | 3366420 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g443650 | (1 of 1) K15627 - tether containing UBX domain for GLUT4 (ASPSCR1, ASPL) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGATGATGTCGCCCCCTAACAGCACAGAGTCCATGTCAGCCACCACGC |
| Internal bar code: | GGGTCAAAGTCATGTGGTCATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4474 |
| LEAP-Seq percent confirming: | 56.1644 |
| LEAP-Seq n confirming: | 41 |
| LEAP-Seq n nonconfirming: | 32 |
| LEAP-Seq n unique pos: | 73 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCGCCCGTCATAGGAAGAC |
| Suggested primer 2: | GCCCCTATACCGTTTACGCA |