| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.044992 |
| Chromosome: | chromosome 16 |
| Location: | 5688158 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g680950 | (1 of 29) IPR029033 - Histidine phosphatase superfamily | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTAGTGGTGCCCCTACCCGCAGTCACACCGCCAAGAAGGAGGAGCAGG |
| Internal bar code: | GGTGACAAAGTGTCCAAGCAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 494 |
| LEAP-Seq percent confirming: | 16.6667 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGGTGGCGTGTACTGGAA |
| Suggested primer 2: | TCAAAAACGCCGAGCTGTTG |