| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.045075 |
| Chromosome: | chromosome 3 |
| Location: | 6915345 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g198200 | GTR11,GSL4,GTR13,BGS4 | (1 of 4) K00706 - 1,3-beta-glucan synthase (E2.4.1.34); Glucan synthase-like 4 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCAGGCGCGCTCGCATGACGTCTGCTCGGGCGGCGGCGAGGCAGCAAC |
| Internal bar code: | GTGCGCCTTGGGTTGCGAGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5389 |
| LEAP-Seq percent confirming: | 55.102 |
| LEAP-Seq n confirming: | 27 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 49 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTGCTGTCTCCCTCCTTGC |
| Suggested primer 2: | TCTGCAAATGTCGCACTCCT |