| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.045110 |
| Chromosome: | chromosome 17 |
| Location: | 3503436 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g724200 | LAL1 | (1 of 1) K11090 - lupus La protein (LA, SSB); La protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTCCATGGCATCGCCGACTGCACCCGCAAGCCGACTGCACCCGTGAGC |
| Internal bar code: | TCGCGGTAACACTAGTCCTGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 265 |
| LEAP-Seq percent confirming: | 4.16667 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCAGATCTTACCCGACCTC |
| Suggested primer 2: | GTGGCTGTAGTCCAACTCCC |