Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.045142 |
Chromosome: | chromosome 3 |
Location: | 6774775 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g196750 | (1 of 4) PF01679 - Proteolipid membrane potential modulator (Pmp3) | CDS/intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACGCCATCAAGTACATCTACGGCGGCCCCCATGCGGCGGATTTCACCAC |
Internal bar code: | TGTTCTAACGTGAGAAATGGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4159 |
LEAP-Seq percent confirming: | 95.7747 |
LEAP-Seq n confirming: | 68 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 71 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCTCCACCAGTAACAGCAT |
Suggested primer 2: | CCATGAGGCCCCTTATCGAC |