| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.045202 |
| Chromosome: | chromosome 1 |
| Location: | 5580926 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g039750 | PDF1B | (1 of 1) PTHR10458//PTHR10458:SF2 - PEPTIDE DEFORMYLASE // PEPTIDE DEFORMYLASE 1B, CHLOROPLASTIC/MITOCHONDRIAL; Peptide deformylase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTGATTCTCAGGAGGAGCAAACTCTCGCGCTGTCTGCTTTAACTCTGG |
| Internal bar code: | GCAACTGCGTAATCCTCATGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 165 |
| LEAP-Seq percent confirming: | 26.087 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTAACCCTGTCCCATCGCAC |
| Suggested primer 2: | GCTGCTGATTGCCTCATTCG |