| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.045202 |
| Chromosome: | chromosome 1 |
| Location: | 5580930 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g039750 | PDF1B | (1 of 1) PTHR10458//PTHR10458:SF2 - PEPTIDE DEFORMYLASE // PEPTIDE DEFORMYLASE 1B, CHLOROPLASTIC/MITOCHONDRIAL; Peptide deformylase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGGCATGCCGGCGTCGAAGAGGAGCGAAACGGAACGCCCCCCCTTCGGT |
| Internal bar code: | AGAGCGCACATGCAGGTTCTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 553 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGCTGATTGCCTCATTCG |
| Suggested primer 2: | TTAACCCTGTCCCATCGCAC |