| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.045203 |
| Chromosome: | chromosome 4 |
| Location: | 525807 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g217931 | P4H14,PFH14 | Prolyl 4-hydroxylase 14; (1 of 2) IPR003582//IPR005123//IPR006620//IPR027450 - ShKT domain // Oxoglutarate/iron-dependent dioxygenase // Prolyl 4-hydroxylase, alpha subunit // Alpha-ketoglutarate-dependent dioxygenase AlkB-like | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGTTCTGGTTCTCGTCATACTGTAATGGATGGGAACCCGATCCCACCCC |
| Internal bar code: | TAGGCGTGGAATACGGCGTTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 677 |
| LEAP-Seq percent confirming: | 71.4286 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGAGGTGCAGTTGGGGTAC |
| Suggested primer 2: | TTCAGAAATGGAAGGGGGCC |