| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.045260 |
| Chromosome: | chromosome 7 |
| Location: | 1174989 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g321150 | CYG15 | Adenylate/guanylate cyclase, nitric oxide sensing; (1 of 5) K12319 - guanylate cyclase soluble subunit beta (GUCY1B) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCGAGGTGAGGTGCACGTGAGGTGGACACATGTATACACCACAGGCAA |
| Internal bar code: | TGGGTCGAATGTGCGAGATTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3513 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 211 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 211 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCACGTTTACTCCTCCCAA |
| Suggested primer 2: | TGCGCAATGCTGAAGGAGTA |