| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.045278 |
| Chromosome: | chromosome 12 |
| Location: | 9696919 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g556228 | NDA7 | Type-II NADH dehydrogenase; (1 of 5) 1.6.5.9 - NADH:ubiquinone reductase (non-electrogenic) / Ubiquinone reductase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCTTGTGACTGTGGCCTGGACGAATCGCCCCATGCCGGGAATGTCCTGC |
| Internal bar code: | AGCGCTTCTGTTATGCGCCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 351 |
| LEAP-Seq percent confirming: | 72.7273 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCCTAGCAAAGAAGGCCA |
| Suggested primer 2: | CCTGCCTCGCCTATCAGATG |