Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.045335 |
Chromosome: | chromosome 13 |
Location: | 3843171 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g589350 | FBB6 | Flagellar/basal body protein 6; (1 of 1) IPR000679//IPR002035//IPR013694 - Zinc finger, GATA-type // von Willebrand factor, type A // VIT domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCATTCTTTTCTGGCGCTACGGCGCGAAAGTACTGTATACTGCAGAGTT |
Internal bar code: | CGGCTCATGGTTGTTGTGGCTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2895 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 66 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 66 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGGTGGACGAGGGACTAGA |
Suggested primer 2: | GGAGAGGACGTAGGTCACCT |