Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.045439 |
Chromosome: | chromosome 16 |
Location: | 4582445 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g671150 | (1 of 1) PTHR12770//PTHR12770:SF22 - FAMILY NOT NAMED // UPF0420 PROTEIN C16ORF58 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACACCCGCACACAACACGCACAATACCGCACACACGCCACACACGCCAC |
Internal bar code: | AGACTGGAGCCTAGGGTGTTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 618 |
LEAP-Seq percent confirming: | 68.4211 |
LEAP-Seq n confirming: | 26 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACATCAGTCAGACCTGCTGC |
Suggested primer 2: | CTACATACCCCGGCGTGTAC |