| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.045502 |
| Chromosome: | chromosome 12 |
| Location: | 5329078 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g528550 | SRD1 | 3-oxo-5-alpha-steroid 4-dehydrogenase family protein; (1 of 1) 1.3.99.5 - 3-oxo-5-alpha-steroid 4-dehydrogenase (acceptor) / Steroid 5-alpha-reductase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAACGCCCGCGTCGCGTGGCTGGTAAGTTGCATGGCCCCTGGGTCGCGTG |
| Internal bar code: | CTTTATCATTTGACGCTTACTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1792 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 43 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACGTTGCACAAGACCACAG |
| Suggested primer 2: | ACAGAGCACGCATAACACCA |