Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.045509 |
Chromosome: | chromosome 15 |
Location: | 395264 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre15.g640900 | (1 of 17) IPR029069 - HotDog domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTGTTTATAGTCTTGGAGTCTGACAGAGGAGCGCGAATCGAGGGCGGG |
Internal bar code: | AGAGATTCGATGCCTATTCGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 217 |
LEAP-Seq percent confirming: | 72.7273 |
LEAP-Seq n confirming: | 8 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCGCCGTCTATGGACTTCC |
Suggested primer 2: | ATGTTGGTTGCGGTTGTTCG |