Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.045653 |
Chromosome: | chromosome 9 |
Location: | 1199602 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g400950 | NCT2 | (1 of 2) PTHR11662:SF3 - INNER MEMBRANE TRANSPORT PROTEIN RHMT; High-affinity nicotinic acid transporter | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTGGAGTGCAAACAGAATACTTTCGCCGACTAGAGATTTTGGCTAACC |
Internal bar code: | ACAATTTAAATCCTAAGGTCTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2808 |
LEAP-Seq percent confirming: | 84.6154 |
LEAP-Seq n confirming: | 33 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGGACGTGGTCATACCGTA |
Suggested primer 2: | GGGGTTCCATGCATGACTCA |