Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.045668 |
Chromosome: | chromosome 12 |
Location: | 3355001 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g498350 | RBM25,SRE1,SRS7 | Pre-mRNA splicing factor, SR-related; (1 of 1) K13168 - splicing factor, arginine/serine-rich 16 (SFRS16) | 3'UTR |
Cre12.g498400 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCGCCCATCCCGCGCGTGCCACCTTCTCACGCCACCGCCATCCCCTCGC |
Internal bar code: | AAGCATTAGATGGTTCTACTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2659 |
LEAP-Seq percent confirming: | 69.0909 |
LEAP-Seq n confirming: | 38 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 55 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTGGGTATGGGTGAGGGTG |
Suggested primer 2: | AAAGGCGTTGAAGCTGCTTG |