| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.045675 |
| Chromosome: | chromosome 7 |
| Location: | 753813 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g317800 | (1 of 1) PF04091 - Exocyst complex subunit Sec15-like (Sec15) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGGGATTCATCAACTGCCTCCTGCCCCGCTCGCGTCGCCGCAGGTGCG |
| Internal bar code: | TTTCATCCTATGTCTTTAGTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 902 |
| LEAP-Seq percent confirming: | 45.4545 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCGACCTCTCACCTCCTTA |
| Suggested primer 2: | TGCTCCGAATCAACTTGGCT |