| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.045696 |
| Chromosome: | chromosome 9 |
| Location: | 6334841 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g414250 | ALG8,GTR20 | (1 of 1) 2.4.1.265 - Dolichyl-P-Glc:Glc(1)Man(9)GlcNAc(2)-PP-dolichol alpha-1,3- glucosyltransferase / Dol-P-Glc:Glc(1)Man(9)GlcNAc(2)-PP-Dol alpha-1->3-glucosyltransferase; Alpha-1%252C3-glucosyltransferase 8 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAACATTGGCGACGTGAGGGAAAAAGCGCTGACCCGGTGGGGTCCATTA |
| Internal bar code: | GTTTTAATCTCCCTTAGGAAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4014 |
| LEAP-Seq percent confirming: | 81.3333 |
| LEAP-Seq n confirming: | 61 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 75 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTTGTACGCCCTTGTCCAT |
| Suggested primer 2: | TCCACTTCCAGTACAACGGC |