| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.045715 |
| Chromosome: | chromosome 2 |
| Location: | 1774377 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g086600 | (1 of 7) PF12680 - SnoaL-like domain (SnoaL_2) | CDS | |
| Cre02.g086650 | SMC2,DIV35 | (1 of 1) K06674 - structural maintenance of chromosome 2 (SMC2); Structural Maintenance of Chromosomes protein | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCAGGCTCGGCAGCTGCAGCTGCAGCAGAGTTCGCACCAGCATGCAGT |
| Internal bar code: | TCGTGGCTTTCCCACGGTGCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2499 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 31 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCCGCACCAGCATTCTTCA |
| Suggested primer 2: | TGCATACGACTTGAAGCCGT |