| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.045739 |
| Chromosome: | chromosome 6 |
| Location: | 6417403 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g293516 | DEGO2 | (1 of 4) PTHR22939:SF83 - PROTEASE DO-LIKE 2, CHLOROPLASTIC; Inactive Deg protease | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCTGCAGTAGGGCTGCCGCCACGGAAGCAGCCACAGCCCACGTACCCA |
| Internal bar code: | GCCTGGGTTTGTCCTCTTACTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 148 |
| LEAP-Seq percent confirming: | 47.619 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCTACTGCTGCTACTGCCG |
| Suggested primer 2: | CACACACAACCTCCTCCTCC |