| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.045755 |
| Chromosome: | chromosome 8 |
| Location: | 4440036 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g385550 | (1 of 80) IPR003882 - Pistil-specific extensin-like protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGTATGGCAGCTGCATCATAATGTCGTACAGCAGTGTGGGGCAGTCGG |
| Internal bar code: | TGGGTTTTCTAGTGTTCGCAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1771 |
| LEAP-Seq percent confirming: | 28.5714 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACACACAGCTGCTGACAC |
| Suggested primer 2: | CCCCTGGCCTTTCTATTGCA |