| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.045761 |
| Chromosome: | chromosome 14 |
| Location: | 1034113 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g614151 | (1 of 1) PF13831//PF13832 - PHD-finger (PHD_2) // PHD-zinc-finger like domain (zf-HC5HC2H_2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTGTGCTTGCATGCACACGCAGGCAGCAGCGTGTGTCCCATCGTGCTA |
| Internal bar code: | GGGAACGACCGGCGGCACGCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3207 |
| LEAP-Seq percent confirming: | 94.7368 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCAACCTACCAAAGCTTGC |
| Suggested primer 2: | TGCTCGAGTTGGTGTCTTCC |