| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.045827 |
| Chromosome: | chromosome 6 |
| Location: | 6123238 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g291400 | GAK2,GALK2 | (1 of 2) IPR006204//IPR006206//IPR013750//IPR020568 - GHMP kinase N-terminal domain // Mevalonate/galactokinase // GHMP kinase, C-terminal domain // Ribosomal protein S5 domain 2-type fold; Galactokinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGGGCGCAATGCGCGCGTACAAGGATAAATGGGCGCCAGAGTTGGTG |
| Internal bar code: | TTCCGGGTAAGGTTTAAATCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2553 |
| LEAP-Seq percent confirming: | 75.6757 |
| LEAP-Seq n confirming: | 28 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTGTGCACTTGTGGTCAG |
| Suggested primer 2: | CACATAGGACAACGTGGGCT |