| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.045833 |
| Chromosome: | chromosome 9 |
| Location: | 4996999 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g405400 | PFD1,PFP3 | Prefoldin molecular chaperone, subunit 1-related protein; (1 of 1) K09548 - prefoldin subunit 1 (PFDN1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGCCCCATCGATCCCAAGAACCCCACGCTGCAGCCTGCACGCCTTTCG |
| Internal bar code: | CGGGCTTTGACCTCTGAGTTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1830 |
| LEAP-Seq percent confirming: | 89.3617 |
| LEAP-Seq n confirming: | 42 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTTCCCTGCATGCAAACCG |
| Suggested primer 2: | TGAACGCCCTTTCTCCACTC |