| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.045865 |
| Chromosome: | chromosome 3 |
| Location: | 5696179 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g186800 | (1 of 2) PF00665//PF07727//PF14223 - Integrase core domain (rve) // Reverse transcriptase (RNA-dependent DNA polymerase) (RVT_2) // gag-polypeptide of LTR copia-type (UBN2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGCCGGGAGTTCAGGTGGTCCAACAGGCTGCGACGCCACGCAAAGTAG |
| Internal bar code: | AACCCAGGTCGATTGTAACAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3986 |
| LEAP-Seq percent confirming: | 85.7143 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGAAGTGGACGGGAAGAGG |
| Suggested primer 2: | CGCCTGCTCCTGGTTCTTAA |