Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.045895 |
Chromosome: | chromosome 6 |
Location: | 2927733 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g273200 | (1 of 1) K03762 - MFS transporter, MHS family, proline/betaine transporter (proP) | outside_mRNA | |
Cre06.g273250 | GPA2,GPAT2 | Glycerol-3-phosphate acyltransferase; (1 of 1) K13506 - glycerol-3-phosphate O-acyltransferase 3/4 (GPAT3_4, AGPAT9, AGPAT6) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTAAACAAGTCCTGTTTGACGGACAGCTGCGTTTCTGCAACCTGTGCT |
Internal bar code: | GGTTCAAGGGAGTAGTGGGACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 118 |
LEAP-Seq percent confirming: | 3.57143 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 27 |
LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAACACCAACCACATGGCTG |
Suggested primer 2: | ACTTGACCTGCTTCCGAGTG |