| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.045901 |
| Chromosome: | chromosome 6 |
| Location: | 840327 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g255600 | EZY24,EZY1,EZY1A | Copy A in the EZY1 tandem gene cluster | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCACCGGCCATATGGGCGGTGGCGCAGGGCGGGCAAGGTTACACGTACG |
| Internal bar code: | CCTAGGTCGACAAGATGTCGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 6783 |
| LEAP-Seq percent confirming: | 27.0833 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 35 |
| LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTTGGCCAGCAACTCAAGG |
| Suggested primer 2: | CTCGAGACGTGTGTGTCACA |