| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.045904 |
| Chromosome: | chromosome 13 |
| Location: | 3171039 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g585050 | (1 of 3) K17285 - selenium-binding protein 1 (SELENBP1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACTCCTACGATTCCTAGCTCCGCGTCGCTACTCCTGGCCGCTAAGTCCA |
| Internal bar code: | GCGGGATTTCATCAAAGTCTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4416 |
| LEAP-Seq percent confirming: | 78.4314 |
| LEAP-Seq n confirming: | 40 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGCCATAAGACCTTGCGC |
| Suggested primer 2: | GAACATCAGCGACTGGACCA |