| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.045914 |
| Chromosome: | chromosome 17 |
| Location: | 2665813 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g716900 | (1 of 1) IPR002104//IPR010998//IPR011010 - Integrase, catalytic domain // Integrase, Lambda-type, N-terminal // DNA breaking-rejoining enzyme, catalytic core | 5'UTR_intron | |
| Cre17.g802054 | (1 of 1) IPR008593//IPR012337 - DNA N-6-adenine-methyltransferase // Ribonuclease H-like domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAGTTTGAATCTATACGGGCGACTAGCACACCAGCGTATATTGCTGCAC |
| Internal bar code: | GCTGCCATGTTTAAGAAAACTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2598 |
| LEAP-Seq percent confirming: | 89.8305 |
| LEAP-Seq n confirming: | 53 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 59 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACACGCACGGCTTAAAAA |
| Suggested primer 2: | GTACTCCTAGAACCGAGCGC |