| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.045949 |
| Chromosome: | mitogenome |
| Location: | 3757 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreMt.g802339 | nad5,ChrepMp03,801492 | NADH dehydrogenase subunit 5; (1 of 1) K03883 - NADH-ubiquinone oxidoreductase chain 5 (ND5) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACATCGGCAATTGGATCAGCGCAAATAGCGGCCAAGTTCAAGATGGTCT |
| Internal bar code: | CTCTTGTGTGCTATATTGATCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2987 |
| LEAP-Seq percent confirming: | 60.0 |
| LEAP-Seq n confirming: | 39 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 65 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCATCGTCTATCCGCCGTT |
| Suggested primer 2: | CGGTCACCAATAGCCCAAGT |