Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.045995 |
Chromosome: | chromosome 12 |
Location: | 4120503 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g517050 | FAP117 | (1 of 7) PF07004 - Sperm-tail PG-rich repeat (SHIPPO-rpt); Flagellar Associated Protein 117 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCTTCCACGGCGGCAGCCGCCGCGCGGACATGGCCAAGGGGCTGCCCG |
Internal bar code: | CATGTACAGTTGATACAGTTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 192 |
LEAP-Seq percent confirming: | 4.54545 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 21 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCACCAAACTTCGTGCCAAG |
Suggested primer 2: | GTTAGCGGCTTTGGTTTGCA |