| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.045995 |
| Chromosome: | chromosome 12 |
| Location: | 4120513 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g517050 | FAP117 | (1 of 7) PF07004 - Sperm-tail PG-rich repeat (SHIPPO-rpt); Flagellar Associated Protein 117 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTCGCCAATCCAACCGGATGCGGGCCTGGCAAAGCACAGCCGGCACAAG |
| Internal bar code: | CATGTACAGTTGATACAGTTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 717 |
| LEAP-Seq percent confirming: | 91.3043 |
| LEAP-Seq n confirming: | 21 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTAGCGGCTTTGGTTTGCA |
| Suggested primer 2: | CCACCAAACTTCGTGCCAAG |