| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.046097 |
| Chromosome: | chromosome 16 |
| Location: | 2105549 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g657700 | (1 of 2) PF13661 - 2OG-Fe(II) oxygenase superfamily (2OG-FeII_Oxy_4) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTTCGGGTTTGTTTCCCGTAACCCCTGCCCGGCCCCCTCACGACACTG |
| Internal bar code: | TTTTGCATAGTAGCCCTTCTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1274 |
| LEAP-Seq percent confirming: | 96.1538 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCCAATTGCTAGCAATGGC |
| Suggested primer 2: | ACCGCAACCTGATGCTTACA |