| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.046114 |
| Chromosome: | chromosome 13 |
| Location: | 4289510 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g592300 | (1 of 1) 1.3.1.91 - tRNA-dihydrouridine(20) synthase (NAD(P)(+)) / tRNA-dihydrouridine synthase 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTAAGGCAAATGCTTACCGGCGGCCATGGGCACTGCGCATTGCAGGAGA |
| Internal bar code: | GGGGAGGCTGCTTTTAATACCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 876 |
| LEAP-Seq percent confirming: | 20.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGCTACAAATGTGCGTACG |
| Suggested primer 2: | CCGCTGCCGATCATAGATGT |