| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.046137 |
| Chromosome: | chromosome 12 |
| Location: | 1574878 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g487350 | CEP19 | Centrosomal Protein 19; (1 of 1) K16801 - centrosomal protein CEP19 (CEP19) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGGGCATGGGGCGATTAGGGTTGCTGTTTGACGCGGAGTCCGGCCGGA |
| Internal bar code: | GGGGCAAGGCCGTGATGATCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2015 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 61 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 61 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGACTCAGCACAGTCAACT |
| Suggested primer 2: | GTGCGCTCCCAACACAATTT |