Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.046297 |
Chromosome: | chromosome 16 |
Location: | 422163 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g693450 | ISG-C1 | (1 of 32) IPR029062 - Class I glutamine amidotransferase-like | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTCACCACCACCGCCACCACCGCCATGCGCGCAGGTGCGCTCCGACGC |
Internal bar code: | TCGAAATTTCACGGTGGAATCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 820 |
LEAP-Seq percent confirming: | 95.2381 |
LEAP-Seq n confirming: | 20 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTAGGCTTTTGTCGCGTCT |
Suggested primer 2: | TCCCTCATCTCCATGCTCCA |