| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.046302 |
| Chromosome: | chromosome 12 |
| Location: | 3864499 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g515150 | (1 of 1) K17784 - mitochondrial inner membrane organizing system protein 1 (MINOS1, MOS1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGGGCTATGGCCCGCCCGCCTGCGCGACTACGTTGCCCTGCAAACTCA |
| Internal bar code: | TGCTATCGCTCCTGCGTAGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4083 |
| LEAP-Seq percent confirming: | 78.7234 |
| LEAP-Seq n confirming: | 37 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATTTTGTGCCCCCAACAGG |
| Suggested primer 2: | ACTTGGTCTTCAGCAGCTCC |