| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.046354 |
| Chromosome: | chromosome 16 |
| Location: | 5228369 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g684450 | (1 of 1) 2.7.11.1//2.7.11.25//2.7.12.2 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase // Mitogen-activated protein kinase kinase kinase / MLTK // Mitogen-activated protein kinase kinase / MKK | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATACCTGCCACCTTGCGAGTCCCCGCGGGACCCCCCCGCCGCCGGTGATC |
| Internal bar code: | TGGCGTGCGTTTGCTACCACAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 476 |
| LEAP-Seq percent confirming: | 35.2941 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACGTTGTCAAACAGGGC |
| Suggested primer 2: | CCTGGTTGGAAGACGACGAA |