| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.046391 |
| Chromosome: | chromosome 16 |
| Location: | 7999385 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g692004 | DNJ21 | (1 of 8) PF00226//PF01556 - DnaJ domain (DnaJ) // DnaJ C terminal domain (DnaJ_C); DnaJ-like protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCCTCTGTTTCCGCCCAGCTGCCCGTCGCCACATCGTGCCCCAGCCCA |
| Internal bar code: | GTTGAATTTCGCAATGGATGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 956 |
| LEAP-Seq percent confirming: | 28.8889 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 32 |
| LEAP-Seq n unique pos: | 45 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTCACCGGAGAAACGTTGC |
| Suggested primer 2: | ATGATTGCTTGGACCCCCAG |