| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.046498 |
| Chromosome: | chromosome 8 |
| Location: | 3199888 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g376720 | CEP7 | Cysteine endopeptidase; (1 of 5) 3.4.22.33 - Fruit bromelain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTACCTGCACCGAACGCGCATGCAGCAGGTACTGCTAGTGAAGAATGAT |
| Internal bar code: | CAAGCTTACCGGCGCCCTTCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3241 |
| LEAP-Seq percent confirming: | 94.2029 |
| LEAP-Seq n confirming: | 65 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 69 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTGCTGACGCACACACATA |
| Suggested primer 2: | GCCCCACGAGTTCTTGATGA |