Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.046509 |
Chromosome: | chromosome 12 |
Location: | 8517046 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g549400 | (1 of 4) PF09366 - Protein of unknown function (DUF1997) (DUF1997) | intron | |
Cre12.g801481 | (1 of 1) IPR000104//IPR003072//IPR018971 - Antifreeze protein, type I // Orphan nuclear receptor, NOR1 type // Protein of unknown function DUF1997 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCTTGCAACCCTCCGCCCTGGGCACCCTGCTAGGACCCGCCATGAATG |
Internal bar code: | ACACTTCGTTTCTCTCTCGCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1111 |
LEAP-Seq percent confirming: | 82.3529 |
LEAP-Seq n confirming: | 14 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTGATGTATCCTGCTCGCT |
Suggested primer 2: | GCCATCTCTATCCCCAGTGC |