| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.046530 |
| Chromosome: | chromosome 5 |
| Location: | 2492967 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g239100 | FPG2 | (1 of 1) 6.3.2.17 - Tetrahydrofolate synthase / Tetrahydrofolylpolyglutamate synthase; Putative folylpolyglutamate synthase | 3'UTR |
| Cre05.g239151 | (1 of 3) 6.3.2.25 - Tubulin--tyrosine ligase / TTL | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCATCTTGTGAGCCATCGTAGCTCGGCGCTAGCATCGAAAGCGGTCAGG |
| Internal bar code: | ATCCTTTTTCCCGGGTCGGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1581 |
| LEAP-Seq percent confirming: | 12.5 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 35 |
| LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGCAGTGGCAGTAGCAGTG |
| Suggested primer 2: | CATCTCCTGTCTTGCTGGGG |