| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.046534 |
| Chromosome: | chromosome 3 |
| Location: | 8228417 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g200100 | PUX10 | Plant UBX domain-containing protein 10; (1 of 1) K18726 - FAS-associated factor 2 (FAF2, UBXD8) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAGGGATCGGTGTCTGGGGTTCGCCTAGCCCCAACGACAGCCCTGCACC |
| Internal bar code: | AGTGCGAACAAATGATTTTATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1176 |
| LEAP-Seq percent confirming: | 83.3333 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCTGATTTGAAGTCGGCCA |
| Suggested primer 2: | TTACAACAGATTCGGGGGCC |