| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.046581 |
| Chromosome: | chromosome 12 |
| Location: | 7208782 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g559150 | CLPS2 | Clp protease adaptor protein; (1 of 1) PTHR33473:SF1 - ATP-DEPENDENT CLP PROTEASE ADAPTER PROTEIN CLPS | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCCAGTCGCTCAGGTCGAAGCCACCCAGCCGCTTGCTGACGTCCACGT |
| Internal bar code: | CTGTGTTATTAGCAATCTAACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3316 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 96 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 96 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACTTGTTCCTGGCGAGACT |
| Suggested primer 2: | GCTACTGACCACCCCAACTC |