| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.046618 |
| Chromosome: | chromosome 8 |
| Location: | 3315521 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g377350 | ADK5,FAP180,FAP121,FAP18 | (1 of 1) 2.7.4.3//2.7.4.8 - Adenylate kinase / Myokinase // Guanylate kinase / Guanosine monophosphate kinase; Flagellar Associated Protein 180 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGAATATATTGGCAAAGTATCCTGGATGGCAGCATCTATCAACTGGGGAC |
| Internal bar code: | CTGGTGCCCCGATCCCCCGCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1532 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 34 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCACGCCCACTACTCTCCT |
| Suggested primer 2: | TTCTCGATAATGGCCCCAGC |