| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.046635 |
| Chromosome: | chromosome 12 |
| Location: | 3270484 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g499300 | PDE31 | (1 of 4) K13293 - cAMP-specific phosphodiesterase 4 (PDE4); 3'%252C5'-cyclic-nucleotide phosphodiesterase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCCTCATCGCCACGTCTGACCCGCTGGCAGTGCGCTACAACGACCGCT |
| Internal bar code: | CCGATGCCAAGTAGGTAAGTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3248 |
| LEAP-Seq percent confirming: | 97.3214 |
| LEAP-Seq n confirming: | 109 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 112 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGTGCGACAGTAGCGTGAA |
| Suggested primer 2: | ATCAGCCAGTTCCGCATCAA |