Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.046636 |
Chromosome: | chromosome 6 |
Location: | 6897307 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g296700 | HYDG1,HYDG | Hydrogenase assembly factor/biotin synthase; (1 of 1) PTHR22976//PTHR22976:SF2 - BIOTIN SYNTHASE // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCCGGTCGCCTCAGGTACCGCAACCCCGCCGAGTGGATCAACGAGGCC |
Internal bar code: | ATATTGTTGTTGATTGACGTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 164 |
LEAP-Seq percent confirming: | 1.92308 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 51 |
LEAP-Seq n unique pos: | 52 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCGGGCGTGTCATCTAGAG |
Suggested primer 2: | AGCCAGCCCCGAAACATAAA |