| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.046740 |
| Chromosome: | chromosome 7 |
| Location: | 5972978 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g354551 | FAP65 | (1 of 2) PTHR10270:SF161 - NUCLEAR CONTROL OF ATPASE PROTEIN 2; Flagellar Associated Protein 65 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCAGGCCTACCGTTGGCGGCCCCACCACAGTCTCCTCCATGCCCAGGC |
| Internal bar code: | ACAAGGGGTCTAGCGTTACGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2530 |
| LEAP-Seq percent confirming: | 46.1538 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTGCACCAGTACATGACGA |
| Suggested primer 2: | TGCTGCTGACGAGGAAGAAG |