Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.046769 |
Chromosome: | chromosome 6 |
Location: | 2013464 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g265300 | CSS2 | Chlamydomonas specific family S protein; (1 of 7) IPR011048 - Cytochrome cd1-nitrite reductase-like, haem d1 domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTCTTGCCTGCAGGGCGCCGTTGCTATCTCCGGCAGCTGGCTCTTCGCC |
Internal bar code: | GCTGTAGCTTAATAGTGTGGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 740 |
LEAP-Seq percent confirming: | 38.8889 |
LEAP-Seq n confirming: | 14 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAAGCCAAAAGGCAGGAAGC |
Suggested primer 2: | TTACACTGGCGCTTGTTTGC |